Bardet-Biedl syndrome 10 (BBS10) - coding DNA reference sequence

(used for mutation description)

(last modified March 28, 2012)


This file was created to facilitate the description of sequence variants in the BBS10 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_016357.1, covering BBS10 transcript NM_024685.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5024
                                     attccgtttccggccgttcccacc       c.-61

 .         .         .         .         .         .                g.5084
 cctgttttcggtcggcccgggtgttctgcaagctggtcaaaaaggggaagcggcccagat       c.-1

          .         .         .         .         .         .       g.5144
 ATGTTAAGTTCTATGGCCGCTGCAGGGTCTGTGAAGGCGGCGTTGCAGGTGGCCGAGGTG       c.60
 M  L  S  S  M  A  A  A  G  S  V  K  A  A  L  Q  V  A  E  V         p.20

          .         .         .         .         .         .       g.5204
 CTGGAAGCCATCGTGAGCTGCTGCGTGGGGCCCGAGGGACGGCAAGTTTTGTGTACGAAG       c.120
 L  E  A  I  V  S  C  C  V  G  P  E  G  R  Q  V  L  C  T  K         p.40

          .         .         .         .         .         .       g.5264
 CCCACTGGCGAGGTGCTTCTCAGCCGGAATGGAGGCCGCCTCCTGGAGGCGCTACACTTA       c.180
 P  T  G  E  V  L  L  S  R  N  G  G  R  L  L  E  A  L  H  L         p.60

          .        | 02.         .         .         .         .    g.5698
 GAGCATCCCATAGCCAG | GATGATAGTGGACTGTGTTTCCAGTCATCTCAAAAAAACAGGA    c.240
 E  H  P  I  A  R  |  M  I  V  D  C  V  S  S  H  L  K  K  T  G      p.80

          .         .         .         .         .         .       g.5758
 GATGGTGCAAAAACATTTATTATCTTTCTTTGCCATTTGCTTAGAGGACTTCATGCAATC       c.300
 D  G  A  K  T  F  I  I  F  L  C  H  L  L  R  G  L  H  A  I         p.100

          .         .         .         .         .         .       g.5818
 ACAGACAGAGAAAAGGATCCTTTGATGTGTGAAAACATTCAAACCCATGGAAGGCATTGG       c.360
 T  D  R  E  K  D  P  L  M  C  E  N  I  Q  T  H  G  R  H  W         p.120

          .         .         .         .         .         .       g.5878
 AAAAATTGTTCTCGGTGGAAATTTATTTCCCAGGCTCTCCTAACGTTTCAGACACAAATA       c.420
 K  N  C  S  R  W  K  F  I  S  Q  A  L  L  T  F  Q  T  Q  I         p.140

          .         .         .         .         .         .       g.5938
 TTAGACGGTATTATGGACCAGTACCTAAGTAGACACTTTTTGTCTATCTTTTCGTCTGCT       c.480
 L  D  G  I  M  D  Q  Y  L  S  R  H  F  L  S  I  F  S  S  A         p.160

          .         .         .         .         .         .       g.5998
 AAAGAGAGAACATTGTGTAGGAGCTCTTTAGAGTTGCTCTTAGAAGCATACTTTTGTGGA       c.540
 K  E  R  T  L  C  R  S  S  L  E  L  L  L  E  A  Y  F  C  G         p.180

          .         .         .         .         .         .       g.6058
 AGAGTGGGAAGAAATAATCATAAATTTATTTCACAGTTGATGTGTGACTACTTTTTCAAG       c.600
 R  V  G  R  N  N  H  K  F  I  S  Q  L  M  C  D  Y  F  F  K         p.200

          .         .         .         .         .         .       g.6118
 TGTATGACTTGTAAAAGTGGGATTGGTGTATTTGAGTTAGTGGATGACCATTTTGTAGAG       c.660
 C  M  T  C  K  S  G  I  G  V  F  E  L  V  D  D  H  F  V  E         p.220

          .         .         .         .         .         .       g.6178
 TTGAATGTTGGTGTCACTGGCCTTCCTGTTTCAGATTCCAGGATCATAGCTGGTCTTGTG       c.720
 L  N  V  G  V  T  G  L  P  V  S  D  S  R  I  I  A  G  L  V         p.240

          .         .         .         .         .         .       g.6238
 CTTCAGAAAGATTTTTCTGTGTACCGCCCAGCAGATGGTGACATGCGAATGGTGATAGTA       c.780
 L  Q  K  D  F  S  V  Y  R  P  A  D  G  D  M  R  M  V  I  V         p.260

          .         .         .         .         .         .       g.6298
 ACAGAAACCATTCAGCCTCTTTTTTCCACTTCTGGATCAGAGTTTATTCTAAATTCAGAA       c.840
 T  E  T  I  Q  P  L  F  S  T  S  G  S  E  F  I  L  N  S  E         p.280

          .         .         .         .         .         .       g.6358
 GCACAGTTTCAGACATCTCAATTTTGGATTATGGAAAAGACAAAAGCAATAATGAAACAT       c.900
 A  Q  F  Q  T  S  Q  F  W  I  M  E  K  T  K  A  I  M  K  H         p.300

          .         .         .         .         .         .       g.6418
 CTACATAGTCAGAATGTAAAATTGCTCATATCTAGTGTGAAACAACCAGATTTAGTTAGT       c.960
 L  H  S  Q  N  V  K  L  L  I  S  S  V  K  Q  P  D  L  V  S         p.320

          .         .         .         .         .         .       g.6478
 TATTATGCAGGGGTGAATGGCATATCAGTGGTTGAGTGTTTATCATCAGAAGAAGTTTCT       c.1020
 Y  Y  A  G  V  N  G  I  S  V  V  E  C  L  S  S  E  E  V  S         p.340

          .         .         .         .         .         .       g.6538
 CTTATCCGGAGGATCATTGGTCTTTCTCCATTTGTACCACCACAGGCCTTTTCGCAGTGT       c.1080
 L  I  R  R  I  I  G  L  S  P  F  V  P  P  Q  A  F  S  Q  C         p.360

          .         .         .         .         .         .       g.6598
 GAAATACCTAACACTGCTTTGGTGAAATTTTGTAAACCTCTTATCCTTAGATCCAAAAGA       c.1140
 E  I  P  N  T  A  L  V  K  F  C  K  P  L  I  L  R  S  K  R         p.380

          .         .         .         .         .         .       g.6658
 TATGTTCATCTAGGCTTGATAAGCACATGTGCATTTATACCACACTCTATAGTTCTTTGT       c.1200
 Y  V  H  L  G  L  I  S  T  C  A  F  I  P  H  S  I  V  L  C         p.400

          .         .         .         .         .         .       g.6718
 GGACCAGTGCATGGTCTCATTGAACAACATGAGGATGCTTTACATGGAGCACTTAAAATG       c.1260
 G  P  V  H  G  L  I  E  Q  H  E  D  A  L  H  G  A  L  K  M         p.420

          .         .         .         .         .         .       g.6778
 CTTCGGCAATTATTTAAAGACCTTGATCTAAATTACATGACACAAACCAATGACCAAAAT       c.1320
 L  R  Q  L  F  K  D  L  D  L  N  Y  M  T  Q  T  N  D  Q  N         p.440

          .         .         .         .         .         .       g.6838
 GGCACTTCAAGTCTTTTTATTTATAAGAACAGTGGAGAAAGTTATCAAGCACCAGATCCT       c.1380
 G  T  S  S  L  F  I  Y  K  N  S  G  E  S  Y  Q  A  P  D  P         p.460

          .         .         .         .         .         .       g.6898
 GGTAATGGCTCAATACAAAGGCCTTATCAGGACACAGTTGCAGAGAACAAAGATGCATTG       c.1440
 G  N  G  S  I  Q  R  P  Y  Q  D  T  V  A  E  N  K  D  A  L         p.480

          .         .         .         .         .         .       g.6958
 GAAAAAACTCAAACATATTTAAAAGTACATTCTAATTTGGTAATTCCAGATGTAGAATTA       c.1500
 E  K  T  Q  T  Y  L  K  V  H  S  N  L  V  I  P  D  V  E  L         p.500

          .         .         .         .         .         .       g.7018
 GAAACATATATTCCGTATTCAACCCCCACACTGACACCAACAGATACATTCCAAACAGTT       c.1560
 E  T  Y  I  P  Y  S  T  P  T  L  T  P  T  D  T  F  Q  T  V         p.520

          .         .         .         .         .         .       g.7078
 GAAACGCTGACATGTTTGTCTTTGGAAAGAAACAGGCTAACTGATTATTATGAACCATTA       c.1620
 E  T  L  T  C  L  S  L  E  R  N  R  L  T  D  Y  Y  E  P  L         p.540

          .         .         .         .         .         .       g.7138
 CTCAAGAACAATTCCACTGCTTATTCAACAAGGGGAAATAGAATAGAAATTTCTTACGAA       c.1680
 L  K  N  N  S  T  A  Y  S  T  R  G  N  R  I  E  I  S  Y  E         p.560

          .         .         .         .         .         .       g.7198
 AATTTACAGGTCACAAATATTACTAGAAAGGGAAGCATGTTACCAGTGAGCTGTAAGTTA       c.1740
 N  L  Q  V  T  N  I  T  R  K  G  S  M  L  P  V  S  C  K  L         p.580

          .         .         .         .         .         .       g.7258
 CCGAATATGGGTACTTCCCAGAGTTACCTTTCCTCATCTATGCCAGCTGGTTGTGTTTTG       c.1800
 P  N  M  G  T  S  Q  S  Y  L  S  S  S  M  P  A  G  C  V  L         p.600

          .         .         .         .         .         .       g.7318
 CCAGTAGGTGGTAATTTTGAGATCTTGTTACATTACTATCTTCTCAATTATGCCAAAAAA       c.1860
 P  V  G  G  N  F  E  I  L  L  H  Y  Y  L  L  N  Y  A  K  K         p.620

          .         .         .         .         .         .       g.7378
 TGCCATCAATCAGAAGAAACCATGGTTAGTATGATAATAGCTAATGCACTTTTAGGCATT       c.1920
 C  H  Q  S  E  E  T  M  V  S  M  I  I  A  N  A  L  L  G  I         p.640

          .         .         .         .         .         .       g.7438
 CCCAAAGTCCTTTATAAATCTAAAACAGGAAAGTACAGCTTTCCACATACATATATAAGA       c.1980
 P  K  V  L  Y  K  S  K  T  G  K  Y  S  F  P  H  T  Y  I  R         p.660

          .         .         .         .         .         .       g.7498
 GCTGTCCATGCACTGCAAACCAATCAACCCTTGGTAAGCAGTCAGACAGGTTTGGAATCA       c.2040
 A  V  H  A  L  Q  T  N  Q  P  L  V  S  S  Q  T  G  L  E  S         p.680

          .         .         .         .         .         .       g.7558
 GTAATGGGTAAATACCAGCTACTAACTTCAGTTCTTCAGTGTTTGACAAAAATATTAACC       c.2100
 V  M  G  K  Y  Q  L  L  T  S  V  L  Q  C  L  T  K  I  L  T         p.700

          .         .         .         .         .         .       g.7618
 ATTGACATGGTAATCACTGTTAAGAGACACCCTCAGAAAGTTCACAATCAAGATTCAGAA       c.2160
 I  D  M  V  I  T  V  K  R  H  P  Q  K  V  H  N  Q  D  S  E         p.720

          .                                                         g.7630
 GATGAACTATAA                                                       c.2172
 D  E  L  X                                                         p.723

          .         .         .         .         .         .       g.7690
 catcagaagtttttaattaaccaaacttttcatctaactcaagccaagtaaagcagtcat       c.*60

          .         .         .         .         .         .       g.7750
 gtgaccactggttctaaagtcagttcagtctacttaggaaaatagcgtaactttaaaagt       c.*120

          .         .         .         .         .         .       g.7810
 ctttagaagaagcacactaaggtcaccagaccagatacaaatattaaattactttatgga       c.*180

          .         .         .         .         .         .       g.7870
 acaaatctagaggggaagccaagatttggctaagtgtgtctgttttttccctattttatg       c.*240

          .         .         .         .         .         .       g.7930
 cctctgtgtctcagctctgtgttagcctatgtgtttaggggagggtttttctttatagct       c.*300

          .         .         .         .         .         .       g.7990
 cctttttactctcctgtatctttttcactccagccctccttcatcgttacatgtttagtt       c.*360

          .         .         .         .         .         .       g.8050
 catagaatcatttaatctctgatttgggtgggcttattctaattgtttttaatattgaat       c.*420

          .         .         .         .         .         .       g.8110
 acattatttgcattaattttccctactcatactttgtaaagctgagtaaaaggctcaaat       c.*480

          .         .         .         .         .         .       g.8170
 tatttttttcaaaaagcataaaattaaattagcagtgagtaaaaggctcaaatttttttt       c.*540

          .         .         .         .         .         .       g.8230
 caaaaagcataaaattaatttttacttttatgtggtcattggtttactgccacttcattt       c.*600

          .         .         .         .         .         .       g.8290
 ggaaaacttggatagattttcacctttgatatacctttgaatatatgttacctgaaatat       c.*660

          .         .         .         .         .         .       g.8350
 aactgtgcattgttaactctttcatttctgtagtaaaaggttaatactagaaaggatatg       c.*720

          .         .         .         .         .         .       g.8410
 caattaatactttgattttctcctgaccccaagagcttgtaaggatatgtcatgtattta       c.*780

          .         .         .         .         .         .       g.8470
 ctggtttttcttgtatctggtgcatagccagagttccacagtaacaaataatttgacaat       c.*840

          .         .         .         .         .         .       g.8530
 ttttatttctaatgtttatttctgttttatttttaatttttatttctaatttatttcatt       c.*900

          .         .         .         .         .         .       g.8590
 tacaaatgttcatattttaaaaacttgtcaatgtaaataatatgatgcatcttatcatgg       c.*960

          .         .         .         .         .         .       g.8650
 acaaggacagtgttttctacctttatcagttctctgtaatacccaaaacagtgctgtatt       c.*1020

          .         .         .         .         .         .       g.8710
 tactccaagtattcagaagtgcttgttgaacaaaacagtgttatctttaattcattcctt       c.*1080

          .         .         .         .         .         .       g.8770
 taaatacatgtttccagtttacttattcaacagattcttacttgggattgactgaagaaa       c.*1140

          .         .         .         .         .         .       g.8830
 aaaaactttaattatagttgaataagtgttgactaatgtattttaaaaactataatatca       c.*1200

          .         .         .         .         .         .       g.8890
 aaattttttatattaaatgtaattctgattttttaaacatttatgctatatgatgcatta       c.*1260

          .         .         .         .         .         .       g.8950
 ttttgtttctgtgaatatggagagaataaattagctcttttgctgaattcatggatgaat       c.*1320

                                                                    g.8957
 gaacttt                                                            c.*1327

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Bardet-Biedl syndrome 10 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 30
©2004-2012 Leiden University Medical Center